Skip Navigation


MBE Advance Access originally published online on January 12, 2008
Molecular Biology and Evolution 2008 25(4):696-708; doi:10.1093/molbev/msn011
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow Supplementary Material
Right arrowOA All Versions of this Article:
25/4/696    most recent
msn011v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Google Scholar
Right arrow Articles by Hasselmann, M.
Right arrow Articles by Beye, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hasselmann, M.
Right arrow Articles by Beye, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2008 The Authors.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.


Research Articles

Evidence for Convergent Nucleotide Evolution and High Allelic Turnover Rates at the complementary sex determiner Gene of Western and Asian Honeybees

Martin Hasselmann*, Xavier Vekemans{dagger}, Jochen Pflugfelder{ddagger}, Nikolaus Koeniger{ddagger}, Gudrun Koeniger{ddagger}, Salim Tingek§ and Martin Beye*

* Heinrich-Heine Universitaet Duesseldorf, Institut fuer Genetik, Universitaetsstr, Duesseldorf, Germany
{dagger} Laboratoire de Génétique et Evolution des Populations Végétales, Unité Mixte de Recherche Centre National de Recherche Scientifique 8016, Université de Lille, Villeneuve d'Ascq, France
{ddagger} Institut für Bienenkunde, Johann-Wolfgang-Goethe Universität Frankfurt/M, Oberursel, Germany
§ Agricultural Research Station Tenom, Tenom, Sabah, Malaysia

E-mail: martin.hasselmann{at}uni-duesseldorf.de.


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
Our understanding of the impact of recombination, mutation, genetic drift, and selection on the evolution of a single gene is still limited. Here we investigate the impact of all these evolutionary forces at the complementary sex determiner (csd) gene that evolves under a balancing mode of selection. Females are heterozygous at the csd gene and males are hemizygous; diploid males are lethal and occur when csd is homozygous. Rare alleles thus have a selective advantage, are seldom lost by the effect of genetic drift, and are maintained over extended periods of time when compared with neutral polymorphisms. Here, we report on the analysis of 17, 19, and 15 csd alleles of Apis cerana, Apis dorsata, and Apis mellifera honeybees, respectively. We observed great heterogeneity of synonymous ({pi}S) and nonsynonymous ({pi}N) polymorphisms across the gene, with a consistent peak in exons 6 and 7. We propose that exons 6 and 7 encode the potential specifying domain (csd-PSD) that has accumulated elevated nucleotide polymorphisms over time by balancing selection. We observed no direct evidence that balancing selection favors the accumulation of nonsynonymous changes at csd-PSD ({pi}N/{pi}S ratios are all <1, ranging from 0.6 to 0.95). We observed an excess of shared nonsynonymous changes, which suggest that strong evolutionary constraints are operating at csd-PSD resulting in the independent accumulation of the same nonsynonymous changes in different alleles across species (convergent evolution). Analysis of csd-PSD genealogy revealed relatively short average coalescence times (~6 Myr), low average synonymous nucleotide diversity ({pi}S < 0.09), and a lack of trans-specific alleles that substantially contrasts with previously analyzed loci under strong balancing selection. We excluded the possibility of a burst of diversification after population bottlenecking and intragenic recombination as explanatory factors, leaving high turnover rates as the explanation for this observation. By comparing observed allele richness and average coalescence times with a simplified model of csd-coalescence, we found that small long-term population sizes (i.e., Ne < 104), but not high mutation rates, can explain short maintenance times, implicating a strong historical impact of genetic drift on the molecular evolution of highly social honeybees.

Key Words: sex determination • balancing selection • genetic drift • social insects • convergent adaptive evolution • molecular evolution • nucleotide polymorphism


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
The complementary sex determiner (csd) gene offers an informative example to study the molecular evolution of a single gene evolving under a well-documented mode of selection (balancing selection) that maintains multiple functional alleles (Beye et al. 2003Go; Hasselmann and Beye 2004Go). The csd determines the sexual fate of the honeybee (Apis mellifera), with the combination of 2 csd alleles in the zygote resulting in a female and 1 unique allele resulting in a male (Beye 2004Go). The csd gene segregates in more than 15 allelic forms in populations (Adams et al. 1977Go; Hasselmann and Beye 2004Go). Bees with a heterozygous csd combination are females and those with a hemizygous copy (haploid, unfertilized eggs) or with a homozygous combination are males. Diploid males, however, are eaten in the larval stage by worker bees. Fertile males are produced from haploid, unfertilized eggs. The strong selection against homozygotes at csd results in a frequency-dependent selection regime. Rare or newly evolved alleles increase in frequency in a population as they will rarely combine to form homozygotes and initiate diploid male development. Very frequent alleles, in contrast, will often form homozygotes. These diploid males are lethal and do not contribute alleles to the next generation, which results in a decrease in the frequency of common alleles. As a general consequence of the rare allele advantage or negative frequency dependence (balancing selection), these alleles are seldom lost by the effect of genetic drift and have a much longer persistence times in populations than neutral alleles (Takahata 1990Go). Consequently, we expect that regions that are under balancing selection have much longer persistence time and have accumulated substantially more nucleotide differences than regions that are unlinked to these sites. Our previous analyses have shown that csd of A. mellifera is evolving under balancing selection and that several regions of the sequence are possible targets of selection (Hasselmann and Beye 2004Go). In addition to finding that recombination has operated among some csd alleles, we have shown as a further sign of balancing selection that the gene has accumulated 10–13 times more variation than the genome-wide average (Hasselmann and Beye 2006Go).

The prolonged persistence time and the accumulation of substantial nucleotide differences within the csd gene offer the possibility to study 1) long-term population processes by the coalescence process and 2) molecular evolution of a single gene under a well-documented mode of selection. The coalescence process of functional alleles with equal fitness evolving under strong balancing selection has been described analytically in models of overdominant selection acting on the major histocompatibility complex (MHC) (Adams et al. 1977Go; Takahata 1990Go) and negative frequency-dependent selection acting on the self-incompatibility S locus of plants (Vekemans and Slatkin 1994Go; Uyenoyama 2003Go). The persistence time of an allele depends on the strength of selection, the rate of origination (mutation to novel alleles), and the loss of alleles by genetic drift, which is a function of population size (Wright 1939, 1960Go; Yokoyama and Nei 1979Go). S alleles and MHC alleles have long overall coalescence times and have been maintained for more than 40 Myr (Ioerger et al. 1990Go; Uyenoyama 1995Go) and 30 Myr (Takahata 1993Go), respectively, as suggested by the observation of trans-specific polymorphisms (some alleles are more closely related to an allele from another species than to other alleles from the same species). Differences in nucleotide divergence among S alleles have been used to infer relative coalescence times and population history (Takahata 1990Go; Richman et al. 1996Go; Richman and Kohn 1999Go) that reflect long-term effective population size. In small populations or in those having experienced a bottleneck, the overall coalescence times are expected to be shorter and the average sequence divergence lower because alleles are more likely to be lost by genetic drift.

In this study, we analyze csd gene sequences of 3 related honeybee species, Apis cerana, Apis dorsata (both Asian honeybee species), and A. mellifera (the western honeybee) that diverged over the last 10 Myr (Sheppard and Berlocher 1989Go; Garnery et al. 1992Go, see Materials and Methods). These species share very similar life histories, have a highly social organization, and show substantial division of labor and reproduction (i.e., they are eusocial).

A survey of nucleotide polymorphisms of genomic fragments supports the notion that balancing selection is also operating among csd of other honeybee species: A. cerana and A. dorsata (Cho et al. 2006Go). However, the latter study relied on fragmented open reading frames (ORFs) in which the relation of ORFs to single alleles was unknown and furthermore included only a very limited set of alleles (i.e., ~8 alleles for A. dorsata of the most variable genomic fragment, excluding neutral variants with low divergence).

Here we analyze for the first time 1) the full-coding sequence of csd from 3 related Apis species (A. cerana, A. dorsata, and A. mellifera) and 2) a significant number of csd alleles (>14). These comprehensive sequence data provide us with the unique power to study the molecular evolution of nucleotide polymorphisms and the coalescence process across different species. Thanks to consistent patterns of nonsynonymous and synonymous polymorphisms across species, we could narrow down the target of balancing selection. This is of importance as the molecular nature of the csd specifying domain is still unknown. By further exploring the distribution of synonymous and nonsynonymous changes, we shed light onto the evolutionary forces that have shaped these specificities. By comparing our empirical results with expectations from an analytic model of the coalescence process, we obtained insights into the long-term population history of these highly social bees.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
Each of the 3 species A. mellifera, A. cerana, and A. dorsata were collected in 2 sampling locations. Geographic locations for A. cerana and A. dorsata were Tenom (Borneo) and Thailand (Samut Songkram for A. cerana and Wanmanaow for A. dorsata) and for A. mellifera were Litija (Slovenia) and Pretoria (South Africa). In each location, 150–300 embryos were collected from 2 colonies. Because of multiple mating of queens, these eggs have 16–28 different sources of chromosomes derived from as many different fathers.

csd sequences were identified from cDNA as described previously (Hasselmann and Beye 2004Go). For A. cerana and A. dorsata, a new set of primers were designed based on sequence information that was obtained from 10 different 5' and 11 different 3' rapid amplification of cDNA ends (RACE) sequences. Templates for RACE experiments (First choice RACE kit: Ambion, Austin, TX) were derived from different geographic locations. The following primers were developed: csd_rev4CIII: TCTCATTATTCAATACGTTGGCATC, csd_forCer2: CTCTAAGCGTGGATTACAGGTT, csd_IIIfor: GTTAAATTTCATWRATATACATATAC, csd_IIIrev3: ATTCAGTTCATTATTCATTATTTGCA, cons2csd_for: TCATAAAAATGAAACGAAATATATC, and the ones used previously (Hasselmann and Beye 2004Go). Primer combinations were as follows: csd_forCer2/csd_rev4CIII/; csd_IIIfor/csd_IIIrev3, and the combinations as described previously (Hasselmann and Beye 2004Go). The csd sequence variants (and fem sequences) were identified from 60 to 100 cloned fragments for each primer pair and sampled by restriction fragment length analysis (Apo I, Mbo I, and Taq I [Fermentas]). The quality of the primer sets was tested on a sample of 15 haploid drones. The csd alleles of all drones were successfully amplified by polymerase chain reaction (PCR). The PCR-induced mutations are lower than 2 in 1,000 nt (sequence data of identical sequences obtained from different high-fidelity PCR amplifications), indicating that PCR-based amplifications do not influence the conclusions of potential specifying domain (csd-PSD) allele analyses that have nucleotide of diversity of ~5% between alleles.

The ORFs of 89 csd sequences were aligned and edited as described elsewhere (Hasselmann and Beye 2004Go). Sequence variants that we classified as neutral variants of a single specificity/allele were excluded from analysis on the basis of clusters of low divergence that form bush-like structures in the genealogy (Hasselmann and Beye 2004Go). These clusters were identified by {pi} estimates and statistical tests (Z-test) on full-coding sequences (Hasselmann and Beye 2004Go). Only 1 sequence for each of these neutral sequence clusters was included in the analysis. This resulted in a final data set of 51 csd alleles (n = 15 for A. mellifera, n = 17 for A. cerana, and n = 19 for A. dorsata). Our classification is supported by the finding that alleles/specificities differ in the structure of the hypervariable domain, whereas the sequences classified as neutral variants have the same repeat structure. Nucleotide polymorphism parameters were calculated using MEGA version 3.1 program (Kumar et al. 2004Go). Trees and genealogies of sequences were constructed using the minimum evolution (ME) method and Kimura's 2-parameter distances. The number of shared polymorphisms and fixed differences between species pairs was calculated by using the Sites program (Hey and Wakeley 1997Go). Linear regression and correlation analyses were performed with the SPSS program (version 12.0). The McDonald–Kreitman test was performed using DnaSP version 4.0 (Rozas J and Rozas R 1999Go).

An estimate of the genomic mutation rate (7 x 10–9 per site per year) is derived from the average pairwise synonymous divergence per site (dS = 0.1) of fem and elongation factor-alpha 1 (EF-{alpha} 1) sequences of A. mellifera and A. cerana and estimates of their divergence times (~7 Myr) (Sheppard and Berlocher 1989Go; Garnery et al. 1992Go) according to the following relationship: number of polymorphisms at synonymous sites that accumulate =2gµ, where g is the number of generations, assuming 1 generation per year for the honeybee, and µ is the mutation rate. From the mutation rate and average synonymous divergence between A. mellifera and A. dorsata for fem and EF-{alpha} 1 sequences (dS = 0.135), a rough estimate of their divergence is obtained (10 Myr).

We derive expectations for the coalescence times of functional alleles at csd following Yokoyama and Nei's (1979)Go model which assumes that sex-determining alleles in honeybees are selectively equivalent and are evolving under overdominant selection with lethal homozygotes. The derivation assumes that new functional alleles are continuously generated under an infinite-allele model of mutation. It also assumes a finite population of Nf and Nm reproductive females and males, respectively, where females are always heterozygotes at csd and males are strictly haploids. Using diffusion approximations, Yokoyama and Nei (1979)Go showed that the homozygosity F at the sex-determining locus is given by

Formula (1)
where u is the mutation rate to new alleles per generation and N is the effective population size computed as N = 9 Nm Nf/(4 Nm + 2 Nf). The effective number of alleles maintained within a population, *n, can then be computed as 1/F. Takahata (1990)Go showed that the coalescence process among functionally distinct alleles at a locus subject to strong overdominant selection is similar to a neutral coalescent but with a timescale expanded by a factor fs, with fs determined by the parameters of the selection model. Takahata's scaling factor fs can be computed, according to Uyenoyama (2003)Go as

Formula (2)
where {lambda} is the turnover rate of alleles that can be computed based on the formula given by Uyenoyama (2003)Go:

Formula (3)
where Formula and Formula (Yokoyama and Nei 1979Go). From (2) and (3) we obtain

Formula (4)

Finally, the pairwise coalescence time of alleles (Td) at csd is given by (Takahata 1990Go)

Formula (5)
and replacing with (4) we finally get

Formula (6)
We computed expected values of *n and Td for a large range of parameter values u and N and compared them with the actual number of alleles observed in the 3 species and with the total coalescence times of alleles estimated based on the application of a molecular clock to the maximum synonymous nucleotide divergence among extant alleles.


    Results
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
We used reverse transcription–polymerase chain reaction to survey allelic diversity of A. mellifera (western honeybee), A. cerana and A. dorsata (the 2 Asian honeybees) from distant geographical locations. We identified 17, 19, and 15 alleles for A. cerana, A. dorsata, and A. mellifera, respectively. The sequences obtained span the full ORF of csd sequences.

Despite substantial variation within and among species in the deduced amino acid sequences, all sequences share the same domains: an arginine/serine-rich domain, a terminal proline-rich domain, and a hypervariable region in between (Beye et al. 2003Go). This observation is consistent with a homologous sex-determining function of csd in the Asian species.

Previous analysis had identified 2 major types (type I and type II [Hasselmann and Beye 2004Go]) of sex-determining alleles. We have confined our analysis to type I that corresponds to the actual csd gene and is the target of balancing selection. With the help of the honeybee genome project, we characterized type II (feminizer, fem) to be a paralog of csd with sex differentiation function downstream of csd (Hasselmann M, Gempe T, Schioett M, Nunes-Silva C, Otte M, Beye M, unpublished data); thus, it is neither the initial signal of sexual regulation nor the target of balancing selection. Consistent with this observation, type II sequences show a near-absence of intraspecies divergence and cluster into a single clade, suggesting that gene duplication occurred before the split of these species (supplementary fig. 1, Supplementary Material online). This finding is inconsistent with a previous report (Cho et al. 2006Go) of partial type I and type II genomic sequences (their fig. 2 and genomic region 1) that were considered to represent trans-specific alleles at a single locus. Even if we confine our analysis to the region that corresponds to the genomic fragment in which Cho et al. (2006)Go detected trans-specific polymorphism, we detected no trans-specific polymorphism (data not shown). An explanation of their finding is that they evidently have not isolated a type II (fem) female sequence from A. cerana (the presented type 2 sequence is not a type II sequence but probably a pseudogene or female intronic sequences that were amplified by the genomic DNA approach) resulting in a misinterpretation of the data set. In this study, we excluded paralog type II (fem) and confined our analysis to csd (former type I) sequences (Hasselmann and Beye 2004Go, 2006Go). Using cDNA sequences, we were able to exclude sequence information of pseudogenes.


Figure 2
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 2.— Genealogy of csd-PSD nucleotide sequences of 3 honeybee species based on the ME method of genetic differences (Kimura's 2-parameter distances). The alleles cluster into 3 clades representing the species Apis mellifera, Apis dorsata, and Apis cerana. The scale on the left represents nucleotide differences per site, whereas the stippled bar marks a burst of diversification among A. cerana alleles (for further information see text). Numbers are bootstrap values exceeding 80%.

 
Common Patterns of Heterogeneity of Nucleotide Diversity
Patterns of average pairwise nonsynonymous ({pi}N) and synonymous ({pi}S) differences per site across exons are reported for each species separately (fig. 1). A striking feature is wide heterogeneity of polymorphism across exons, with some displaying extremely high mean synonymous or nonsynonymous diversity. There is also substantial variation around the mean pairwise nucleotide differences, suggesting that similar and divergent alleles coexist within species representing different divergence times.


Figure 1
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 1.— Average pairwise nonsynonymous ({pi}N) and synonymous ({pi}S) differences per site of exons for 3 honeybee species (A) Apis mellifera, (B) Apis dorsata, and (C) Apis cerana. Average nonsynonymous ({pi}N) and synonymous ({pi}S) differences per site per exon are presented with their standard errors. Sequence assignment to exons is based on A. mellifera csd gene structure (Beye et al. 2003Go). Exon 9, which encodes only 9 amino acids, was excluded from the analysis. Number of alleles included are 15, 19, and 17 for A. mellifera, A. dorsata, and A. cerana, respectively.

 
In A. mellifera and A. dorsata, the nonsynonymous differences ({pi}N) are consistently the highest in exons 6 and 7 ({pi}N > 0.05), whereas {pi}N is lower for exons 1–5 ({pi}N < 0.05). This suggests that at least exons 6 and 7 are targets of balancing selection that have extended maintenance times and thus have accumulated more nucleotide differences. Assuming exons 6 and 7 are the only targets of selection, the decline of {pi}N among other exons could be due to the strength of genetic hitchhiking to the target sites of selection or to relaxed evolutionary constraints. Because sites that are genetically linked to the target of selection are also maintained over extended periods of time, they also accumulate more nucleotide differences. Recombination, however, decouples and relaxes the impact of balancing selection, leading to a decline of polymorphism at this locus (Hasselmann and Beye 2006Go). Considerable higher {pi}N in exon 8 than in exons 2–5 can thus presumably be the result of stronger genetic linkage and smaller genomic distances of exon 8 to the target of selection exons 6 and 7 (the genetic distance of exon 8–exon 7 is 60 bp, whereas that between exons 5 and 6 is 3.9 kb). In A. cerana, exons 4 and 5 have the highest {pi}N. However, this enhanced polymorphism results from divergence between 2 sequence clusters (O and T type), which are characterized by low intracluster differences (supplementary fig. 2, Supplementary Material online), suggesting that this part of the sequence is not a general target of balancing selection across species. Polymorphisms of the T type for exon 5 and part of exon 4 are more similar to A. dorsata polymorphisms (data not shown), suggesting that this restricted region harbors trans-specific polymorphisms.

The synonymous differences follow the heterogeneous patterns of nonsynonymous differences across exons, with maximum {pi}S values in exons 6 and 7 in A. mellifera and A. dorsata ({pi}S > 0.05). This observation is consistent with the prediction that synonymous differences accumulate in regions of tight genetic linkage to sites under balancing selection (Schierup et al. 2000Go). When A. cerana sequences are separated into 2 clusters, O and T (supplementary fig. 2, Supplementary Material online), intracluster {pi}S values follow the pattern in the other species with low {pi}S in exon 5 but high {pi}S in exons 6 and 7 and that extends to exon 8.

Based on the comparative analysis of nonsynonymous and synonymous nucleotide polymorphisms across species, we propose that exons 6 and 7 are a common target of selection across species. Targets of selection in exons 6 and 7 are nonsynonymous sites that encode amino acids determining the specificity of an allele in the sex determination process. We suggest that exons 6 and 7 encode the csd-PSD.

Short Coalescence Times in csd Genealogies
The relationship among csd-PSD sequences is reflected by their genealogy (fig. 2). The alleles fall into 3 clades, supported by bootstrap values >90%, such that each clade represents a single species (see also supplementary fig. 1 [Supplementary Material online] for the whole sequence). Hence, no trans-specific allelic pattern of the common target of selection, csd-PSD, is observed in these honeybee species that have been separated by maximally 10 Myr (see Materials and Methods). This contrasts remarkably with the general pattern observed in other loci under balancing selection such as the S locus and the MHC complex in which several trans-specific alleles have been observed even after 30–40 Myr of species separation but is consistent with the relatively low average synonymous nucleotide diversity in each bee species ({pi}S = 0.089 for A. mellifera, {pi}S = 0.032 for A. cerana, and {pi}S = 0.069 for A. dorsata). A lack of trans-specific lineages could be due 1) to bursts of diversification of csd alleles that occurred after the speciation events, 2) to the process of recombination in which trans-specific allelic patterns are lost, or 3) to high allelic turnover rates leading to short coalescence times among csd alleles.

1) A burst of diversification of alleles after each speciation event is not a general explanation for the lack of trans-specific alleles at csd. Such diversification of csd alleles over short evolutionary time (e.g., after a bottleneck) would be consistent with a star-like structure in the genealogy. However, this is only observed in parts of the A. cerana genealogy (alleles marked by a stippled bar in fig. 2) in which the genealogy has substantially reduced internal branches when compared with other internal branches of the same species (Mann–Whitney U test. P < 0.01) or other species (P < 0.002). Another argument against a burst of diversification is that the observed nucleotide diversity at the csd-PSD is largely compatible with the expected coalescence process at equilibrium. Under a conservative assumption, all sex determination alleles have equal fitness and equal probability of extinction because alleles with lower fitness will have a higher probability of extinction. Thus, the expected genealogical relationships will be similar to sampled neutral gene genealogies (Takahata 1990Go). A way to test this is to compare ratios of the largest with mean number of synonymous and nonsynonymous differences that is close to 2(1–1/i) for i sampled alleles (Takahata et al. 1992Go). The ratios for nonsynonymous differences are close to the expected values for A. mellifera and A. cerana (table 1) and slightly larger for A. dorsata. We detected, however, no significant differences between the observed and expected ratios of the largest and the mean nucleotide differences (Fisher's exact test, P > 0.05 for all comparisons applied to the absolute numbers of synonymous and nonsynonymous differences).
2) The process of intragenic recombination at csd-PSD within each species could reassemble ancestral polymorphisms in independent combinations resulting in a loss of trans-specific alleles. Such a process involving recombination and genetic drift will slow down the accumulation of synonymous differences because synonymous polymorphisms but not nonsynonymous polymorphisms maintained by balancing selection would become sensitive to the process of genetic drift. The plot of mean synonymous and nonsynonymous differences for each species (supplementary fig. 3A–C, Supplementary Material online) shows that the 2 types of polymorphism are highly correlated; the more synonymous differences that have accumulated, the older an allele, the more nonsynonymous differences that have accumulated over time. This is consistent with a tight linkage of synonymous to nonsynonymous sites (Spearman rank correlation, 2-tailed, A. dorsata: rho = 0.55; P < 0.001, A. cerana: rho = 0.45; P < 0.001, and A. mellifera: rho = 0.27; P < 0.01). To investigate whether some alleles deviate from this general pattern of tight linkage of synonymous (S) and nonsynonymous (N) polymorphisms given the mean S/N ratios (0.32, 0.29, and 0.32 for A. mellifera, A. cerana, and A. dorsata, respectively), we assumed a binomial distribution from which the 95% confidence interval (CI) was set. The distribution is so broad as to be largely compatible with the data. Some allelic pairs, however, exhibit unusual values of S and N. This approach identifies 6 of 171 A. dorsata and 2 of 120 of A. mellifera and none of 153 A. cerana allele pairs that have less synonymous changes than expected.
3) High allelic turnover rates leading to short coalescence times among csd-PSD alleles could also explain the lack of trans-specific lineages. We estimate coalescence times of alleles based on the application of a molecular clock to the maximum synonymous nucleotide divergence among alleles that have accumulated by mutation. The largest synonymous differences per corresponding site (dS) between alleles in csd-PSD are 0.2, 0.23, and 0.11 for A. mellifera, A. dorsata, and A. cerana, respectively. If the neutral mutation rate is about 7 x 10–9 per site per year (compared with 15 x 10–9 per site per year for Drosophila), as estimates from divergence of gene sequences and speciation events suggest (see Materials and Methods), it must have taken about 14.6 Myr or generations in A. mellifera, 16.7 Myr in A. dorsata, and 7.9 Myr in A. cerana for these synonymous differences to accumulate (number of synonymous sites that accumulate =2gµ with g number of generations and 1 generation per year for the honeybee and µ the mutation rate). None of the A. cerana alleles are substantially older than the most recent species split between A. mellifera and A. cerana (estimated at about 6–8 Myr) as the largest allelic divergence (dS = 0.11) is in the order of mean interspecies divergence (dS = 0.1, see Materials and Methods). This is consistent with the absence of trans-specific alleles in this species. However, 4 and 6 allelic lineages of A. mellifera and A. dorsata, respectively, could have predated speciation as divergence of allele pairs exceeds mean interspecies divergence (dS > 0.14). Thus, based on our rough computations, trans-specific patterns could have been observed among A. dorsata and A. mellifera. Assuming that the ancestral species possessed 20 alleles, the probability that the historical sample of 4 and 6 allelic lineages did not overlap, that is, that the 2 descendant species have no trans-specific alleles, is as high as P > 0.2 when we apply the hypergeometrical distribution.


View this table:
[in this window]
[in a new window]

 
Table 1 The Pairwise Largest and Mean Synonymous (S) and Nonsynonymous (N) Differences of csd-PSD

 
To explore which factor is most likely responsible for the short coalescence times in bees and the observed low average synonymous nucleotide diversity, we applied a theoretical model of the coalescence process (see Material and Methods) to compare with our empirical data. The coalescence process generating allelic genealogies at csd can be approximated using Takahata's (1990)Go coalescent approach applied to the diffusion analysis of the sex-determining locus in the honeybee (Yokoyama and Nei 1979Go). Takahata's main result is that the scale of the coalescence process for alleles under balancing selection is determined not only by the effect of genetic drift that is determined by the effective population size Ne but also depends strongly on the rate of origin of new specificities, u. An upper bound of u = 10–6 (per gene per year) can be computed based on the genomic mutation rate and the assumption that any change among the 167 nonsynonymous sites at csd-PSD would give rise to a new allelic specificity (u = µ x d with u the rate of origin of new alleles per gene per year, µ genomic mutation rate, and d number of nonsynonymous sites within csd-PSD). This estimate is, however, unrealistically high because of functional constraints in the protein sequence (see below). The lower bound of u = 10–8 is close to the mutation rate per site when a single-specific site change within csd-PSD is required for a new allele to originate (u = µ; rate of origin of new alleles equals the mutation rate). Given these broad bounds of the rate of origin of new alleles, we computed the number of expected alleles (*n) and expected pairwise coalescence times of alleles (Td) as a function of the long-term effective population size Ne (fig. 3). It can be seen that the observed number of alleles in honeybees (n {approx} 20) enforces a strong constraint on the effective population size, with compatible Ne values ranging between 1,500 and 4,000 individuals assuming a rate of origin of new alleles of 10–8 to 10–7 (fig. 3A). In contrast, the inferred average pairwise coalescence time of alleles of about 6 Myr or generations (as estimated from the average synonymous divergence of A. dorsata and A. mellifera alleles) is compatible with a wider range of Ne values (250–106 individuals, fig. 3B) given a rate of origin of new alleles of 10–8 to 10–7. Putting together theoretical expectations and empirical data, we conclude that the observed coalescence times are most likely explained by a moderate rate of origin of new alleles and a strikingly small long-term effective population size (Ne < 104) for A. mellifera and A. dorsata. Hypothesized Ne is even lower for A. cerana harboring less nucleotide diversity. In the above calculations, we assumed a long-term generation time of 1 year for these social bees. This assumption is not critical for our upper bound estimate of long-term effective population sizes as generation times of more than 1 year will result in an even lower population size estimate.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 3.— Expected values of (A) the effective number of alleles (*n) and (B) the average pairwise coalescence times of alleles (Td) for a wide range of values of the parameters N (effective population size) and u (mutation rate to new functional alleles) under a model of a sex determination locus subject to overdominant selection with lethal homozygotes. Increasing values of u (from 10–8 to 10–5 mutations per generation) are represented by increasingly thicker solid lines. The broken horizontal lines indicate the range of N values that are consistent with the values of *n and Td observed in the present study.

 
Excess of Shared Nonysynonymous but Not Synonymous Changes
The csd-PSD has on average less nonsynonymous than synonymous polymorphisms per nonsynonymous and synonymous site ({pi}N/{pi}S: 0.6, 0.95, and 0.73 for A. mellifera, A. dorsata, and A. cerana, respectively). The {pi}N/{pi}S > 1 would constitute direct evidence that balancing selection favors the accumulation of nonsynonymous changes and thus the origin of new allelic variants. To test for adaptive nonsynonymous changes, we first applied the McDonald–Kreitman test on csd-PSD alleles. The test detected no significant excess of nonsynonymous substitutions or polymorphisms in all species comparisons (P > 0.3). Notably, we identified a substantial excess of shared nonsynonymous but not synonymous changes at csd-PSD (table 2). These changes are shared as they have at least 2 of the same nucleotides in common between alleles across species. These nonsynonymous changes, however, have no common evolutionary origin. They accumulated independently in different alleles across species (homoplasy) because we found no trans-specific alleles in the phylogenetic analysis (fig. 2). Furthermore, under trans-specific evolution, we would expect to observe an excess of shared synonymous sites as well, as these sites are tightly linked to nonsynonymous sites (the impact of recombination is negligibly low). As an explanation for the substantial excess of shared nonsynonymous changes, we propose that only a limited number of nonsynonymous mutations evolved and accumulated across species. These evolutionary constraints of the CSD protein may be the result of purifying selection that removes deleterious mutations. Alternatively, evolutionary constraints may be a consequence of selection favoring new allelic variants that are restricted to only a subset of nonsynonymous changes. We next asked what portion of all possible nonsynonymous changes can accumulate and evolve in a way that supports the observed pattern of homoplasy when the hypergeometrical distribution is applied (fig. 4). In this simplified model, we assume that selection operates equally across species. The highest probability of obtaining these shared numbers is found when ~25% of all possible changes can evolve (fig. 4). This estimate is very robust over all species pairs (similar probability distributions), suggesting that comparable numbers of nonsynonymous changes are evolutionary constrained across species. When we correct the {pi}N/{pi}S ratios for the portion of changes that can possibly evolve, the 25% estimate we calculated from the number of homoplasic changes across species, {pi}Nsp/{pi}S becomes 2.4, 3.8, and 2.9 ({pi}Nsp = 4{pi}N) for A. mellifera, A. dorsata, and A. cerana, respectively. These estimates suggest that a substantial fraction of nonsynonymous changes have been favored by balancing selection.


View this table:
[in this window]
[in a new window]

 
Table 2 Numbers and Shared Numbers of Synonymous (S) and Nonsynonymous (N) Polymorphisms

 

Figure 4
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 4.— The probabilities (P) of observing the detected number of shared nonsynonymous changes (see table 2) given the different proportions of nonsynonymous changes that can evolve among csd-PSD alleles. Probability estimates were obtained by applying the hypergeometrical distribution to the data of table 2. The probability distribution of the species pair Apis mellifera/Apis cerana is shown by triangles, A. mellifera/Apis dorsata by squares, and A. dorsata/A. cerana by diamonds. We approximate the total number of possible nonsynonymous changes to 501 based on the numbers of 167 nonsynonymous sites.

 
We further analyzed the relation of {pi}N and {pi}S and asked whether ratios of {pi}N/{pi}S change with different values of {pi}S. The {pi}S accumulates over evolutionary time; thus, low {pi}S indicates alleles that have newly diverged from each other (newly diverged allele pairs), whereas high {pi}S points to alleles that have diverged a long time ago (anciently diverged allele pairs). Figure 5 shows the scatter blot of {pi}S versus {pi}N of allele pairs and the linear regressions (fig. 5). The {pi}N/{pi}S ratio is in all 3 species not constant for low and high {pi}S (newly and anciently diverged allele pairs) as shown by the regression lines. For newly diverged alleles, the regression line is above the {pi}N/{pi}S = 1 ratio (represented by the dotted line in fig. 5), whereas for anciently diverged alleles, the regression line drops below {pi}N/{pi}S = 1. This higher evolutionary rate of newly diverged alleles could indicate balancing selection enhancing the accumulation of nonsynonymous changes, or alternatively, could suggest a downward bias of {pi}N/{pi}S estimate due to {pi}S signal saturation. The {pi}S values <0.2, however, are far from signal saturation, suggesting that selection for new allelic variants played a role in the accelerated evolutionary rate among newly diverged alleles.


Figure 5
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 5.— Scatter plots and linear regression analysis of nonsynonymous ({pi}N) versus synonymous ({pi}S) differences per site for all pairwise comparisons of (A) Apis mellifera (P < 0.05, R2 = 0.06), (B) Apis dorsata (P < 0.001, R2 = 0.46), and (C) Apis cerana (P < 0.001, R2 = 0.18). The dashed line shows the 1:1 ratio of synonymous to nonsynonymous changes per site.

 
The Hypervariable Domain Encodes 2 Different Asparagine/Tyrosine-Rich Motifs
The hypervariable region consists of a variable number of repeats and is located within the csd-PSD (fig. 6). Because of the ambiguous relation of these sites, they were not included in the former polymorphism analyses. The repeat encodes a basic ((N)1–5/Y) sequence motif of asparagine/tyrosine residues. This basic sequence motif is modified at the end of each reiteration by either a set of 2 amino acids (KK less often with KP, KQ) or with the more complex ((KHYN)1–4)KH motif. This combination is reiterated 3–7 times, encoding peptides of varying length. The former repeat ending is observed in all 3 species (with only 1 representative in A. dorsata), whereas the latter 1 is confined to A. cerana and A. dorsata. We propose that the ((KHYN)1–4)KH motif has most likely been lost in the A. mellifera lineage as it was obviously present in the most recent common ancestor of A. cerana and A. mellifera. The observation that the numbers of repeats and motifs vary between alleles suggest functional significance of this domain in specifying sex determination alleles.


Figure 6
View larger version (82K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 6.— Aligned conceptual translations spanning the hypervariable region of 3 honeybee species. This region was excluded in the csd-PSD nucleotide polymorphism and divergence analysis because of the ambiguous relation of these sites. The region encodes a basic ((N)1–5/Y) sequence motif that is modified at the end by either a set of 2 amino acids (KK less often with KP, KQ) or with the more complex ((KHYN)1–4)KH motif. This hypervariable region reiterates 3–7 times, giving rise to peptides of varying length. Two alleles of Apis cerana have the same repeat structure.

 

    Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
The csd-PSD Is a General Target of Balancing Selection
The heterogeneity among exons in substitution rates suggests that the combined evolutionary forces of balancing selection, mutation, recombination, and genetic drift have shaped the pattern of synonymous and nonsynonymous polymorphisms at csd in the 3 bee species A. mellifera, A. cerana, and A. dorsata (fig. 1). Balancing selection maintains polymorphisms at nonsynonymous sites over extended periods, providing time for synonymous mutations to accumulate as well. Recombination among exons decouples this process and, with loose linkage, these changes are more likely to become lost by the effect of genetic drift. Thus, in regions immediately surrounding the targets of balancing selection, high levels of synonymous polymorphisms are expected (Hudson and Kaplan 1988Go). The consistently high levels of synonymous differences across species in exons 6 and 7, therefore, serve to narrow down the target of balancing selection to csd-PSD. Nonsynonymous differences evolve with both direct and indirect effects of selection (e.g., purifying selection) and are thus less informative to narrow down the target of balancing selection. Regardless of these potential restrictions, nonsynonymous differences follow very well the synonymous pattern, suggesting that balancing selection is a strong selective force operating at csd-PSD nonsynonymous sites. Compatible with csd-PSD being the target of selection, we have identified a coiled coil domain (Burkhard et al. 2001Go) that has the capability to be part of the specifying domain by its protein interaction (Beye 2004Go). An exception of exons 6 and 7 having the highest {pi}S values is found between exons 8 and 7 of A. cerana O cluster that have comparable {pi}S values (supplementary fig. 2, Supplementary Material online). We propose that selection may operate differently among sequences of the O cluster, or, alternatively, similar values result from the broad distribution of nucleotide diversity generated by the stochastic nature of the evolutionary process. The decline of {pi}S around csd-PSD indicates that recombination events between exons have contributed to the evolution of csd sequences. Direct estimates for recombination rates within the csd gene, however, have shown so far a drastic suppression of recombination activity in the csd gene, at least for A. mellifera (Hasselmann and Beye 2006Go). We propose that even very rare recombination events leave their signatures in the sequence because alleles have extended maintenance times. A similar pattern of a decline in synonymous diversity around the target of balancing selection, the peptide-binding site, has been observed in the human leukocyte antigen genes within the MHC system (Takahata and Satta 1998Go).

Short Coalescence Times Relates to Long-Term Small Population Sizes
When compared with other genetic systems under strong balancing selection, csd-PSD alleles have relatively short average coalescence times (~6 Myr) and low average synonymous nucleotide diversity ({pi}S = 0.032–0.089). In addition, we have not identified trans-specific csd-PSD alleles among species although the separation times of these species are very short (~7 and 10 Myr). For plant self-incompatibility systems, diversity of synonymous sites in the recognition domain within Arabidopsis lyrata is more than 4 times larger (Charlesworth et al. 2003Go), and several trans-specific allelic lineages have been observed in a variety of species (Ioerger et al. 1990Go; Uyenoyama 1995Go; Castric and Vekemans 2004Go) that correspond to separation times of up to 40 Myr. As general explanations for the relatively short average coalescence times, we discarded the effect of intragenic recombination as we observed a strong correlation between numbers of synonymous and nonsynonymous differences. We also excluded the possibility of major bottlenecks as the csd-PSD genealogy is largely compatible with the expected ratios of the largest to mean diversity under the assumption of equilibrium, although some size restriction has affected the A. cerana population (see below). We suggest that relative low nucleotide diversity is mostly compatible with the occurrence of higher allelic turnover rates of csd alleles when compared with other loci that are under balancing selections. The relative high allelic turnover rates of the csd-PSD locus under strong balancing selection could result from either a high rate of origin of new alleles or a small long-term effective population sizes. By comparing our data with a csd-coalescence model, we discarded the former explanation as this would generate substantially greater allelic richness than that observed. Hence, we conclude that small long-term population sizes, that is, Ne < 104, are the most likely explanation for the observed patterns of divergence. As a general consequence, this finding would implicate genetic drift as a very strong, long-term evolutionary force in highly social honeybees. The even lower divergence and overall coalescence times of A. cerana alleles are suggestive of an additional, but temporal, restriction in population size as seen by a burst of diversification in some allelic lineages. This is seen by the significantly shorter internal branches when compared with other branches of the phylogeny (fig. 2). Such a burst of diversification after a population bottleneck has been previously described for self-incompatibility alleles of Physalis crassifolia (Richman et al. 1996Go).

We hypothesize that small long-term population size in these honeybees is a consequence of highly social organization. The strong division of reproduction among individuals under highly social organization results in a dramatic decrease in long-term effective population size (Wilson 1963Go; Crozier 1979Go; Pamilo and Crozier 1997Go). Thousands of sterile female worker bees are headed by a single reproductive queen, thus substantially reducing the size of the breeding population relative to the total number of individuals that can be sustained by the local environment. Under balancing selection, the estimate of Ne is not strongly affected by population structure (Schierup et al. 2000Go) so that it truly represents the size of the breeding population at the species level.

The long-term estimates can be related to short-term estimates of effective population size based on neutral polymorphism data for A. mellifera. When applying a mutation rate µ = 7 x 10–9 per site per generation and the mean nucleotide diversity {pi} = 0.0049 +/– 0.0013 standard error of neutral polymorphisms (Beye et al. 2006Go) to {pi} = Ne x µ, Ne becomes 70,000 (with a CI of 30,000–110,000). The greater short-term over long-term effective population size would indicate a recent expansion and/or substructuring of European honeybee populations (A. mellifera). This is supported by biogeographic molecular studies that have shown an expansion and differentiation of A. mellifera in Europe and Africa over the last 0.7–1.3 Myr (Garnery et al. 1992Go; Arias and Sheppard 2005Go). In contrast to strongly balanced polymorphisms, these neutral polymorphisms are strongly affected by the substructure of populations thus making both estimates less comparable.

Convergent and Adaptive Evolution of Nonsynonymous Changes at csd-PSD
The observed {pi}N/{pi}S ratios for csd-PSD ({pi}N/{pi}S = 0.6–0.9) are above average estimates from other genes (0.12 and 0.2 for Drosophila melanogaster and Drosophila simulans, respectively (Eyre-Walker et al. 2002Go), which suggests that the csd gene is under strong balancing selection favoring new rare allelic variants and nonsynonymous changes or that it has substantially relaxed functional constraints. We identified a substantial excess of shared nonsynonymous changes at csd-PSD that accumulated independently in different alleles across species (homoplasy). This provides indirect evidence that positive selection has favored some specific nonsynonymous changes. The lack of trans-specific alleles and the absence of an excess of synonymous changes suggest that the excess of shared nonsynonymous changes have an independent evolutionary origin. In a simplified model, we have approximated that only ~25% of all possible nonsynonymous changes can evolve to become compatible with the observed numbers of shared polymorphisms. Our approximation is constant over all species pairs, suggesting that equivalent evolutionary constraints at csd-PSD are operating across species. If we correct for the limited numbers (non constrained changes) of possible nonsynonymous changes that can evolve, {pi}N/{pi}S becomes substantially >1 (corrected estimates: {pi}Nsp/{pi}S ranges from 2.4 to 3.8). Selection on a confined subset of nonsynonymous changes thus masks the strong effect of selection for new specificities, which is usually revealed by {pi}N/{pi}S ratios >1. The polymorphisms that evolved convergently at csd-PSD could be very informative to identify molecular determinants of allelic specificity. Significantly, these shared sites are scattered across csd-PSD, suggesting that functionally relevant polymorphisms are not confined to a specific region.

The hypervariable region most likely adds to the specificity of alleles. We identified 2 basic peptide motifs across species, suggesting their evolutionary origin in a common ancestor. These regions further diversify in the different honeybee lineages essentially by changing the number of repeats. A recent study (Cho et al. 2006Go) claimed to have identified species-specific repeat structures. Our study, which includes a sophisticated set of alleles relying on transcribed sequences (thus excluding possible noncoding sequences of the genomic fragment approach [Cho et al. 2006Go]), showed the contrary.

The finding of higher {pi}N/{pi}S ratios of newly over anciently diverged alleles (fig. 5) is additional evidence that balancing selection has favored nonsynonymous changes at csd-PSD. Balancing selection has enhanced the relative rate of accumulation of nonsynonymous changes among newly diverged alleles. These enhanced evolutionary rates of newly diverged alleles may also explain our previous report on longer terminal over internal branches in the csd genealogy (Hasselmann and Beye 2004Go). This longer terminal branch pattern is unexpected from theory (Uyenoyama 1997Go) but has also been reported for S allele genealogies (Richman and Kohn 1999Go).

Overall, this study has deciphered a complex pattern of evolutionary forces (selection, genetic drift, mutation, and recombination) that have shaped nucleotide polymorphism at csd-PSD and linked sites. A conclusive test of these evolutionary genetic evidences awaits detailed functional analysis. This will provide further evidence that the csd-PSD corresponds to the specifying domain and that shared polymorphisms are informative to identify the molecular determinants of allele specificity and protein activation (Beye et al. 2003Go; Beye 2004Go). This merged approach will give a more detailed understanding of how selection has shaped nucleotide diversity and the function of alleles. Extending studies on allelic richness and nucleotide diversity to other bee species will decipher whether social organization is generally associated with a high turnover rate of sex determination alleles and small long-term effective population sizes. Such a general association will have implications for the understand of natural selection in relation to social organization (Pamilo and Crozier 1997Go) and may have broad consequences such as genome-wide high recombination rates (Beye et al. 2006Go).


    Supplementary Material
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
All new csd and fem sequences presented in this paper are found in GenBank under accession numbers EU100885–EU100941. Supplementary figures 1–3 are available at Molecular Biology and Evolution online (http://www.mbe.oxfordjournals.org/).


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
We thank very much Ross Crozier, George Heimpel, Robert Paxton, and 2 anonymous reviewers for very helpful comments and corrections on an earlier version of the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft.


    Footnotes
 
Diethard Tautz, Associate Editor Back


    References
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 

    Adams J, Rothman ED, Kerr WE, Paulino ZL. Estimation of the number of sex alleles and queen matings from diploid male frequencies in a population of Apis mellifera. Genetics (1977) 86:583–596.[Abstract/Free Full Text]

    Arias MC, Sheppard WS. Phylogenetic relationships of honey bees (Hymenoptera:Apinae:Apini) inferred from nuclear and mitochondrial DNA sequence data. Mol Phylogenet Evol (2005) 37:25–35.[CrossRef][ISI][Medline]

    Beye M. The dice of fate: the csd gene and how its allelic composition regulates sexual development in the honey bee, Apis mellifera. Bioessays (2004) 26:1131–1139.[CrossRef][ISI][Medline]

    Beye M, Gattermeier I, Hasselmann M, et al, (15 co-authors). Exceptionally high levels of recombination across the honey bee genome. Genome Res (2006) 16:1339–1344.[Abstract/Free Full Text]

    Beye M, Hasselmann M, Fondrk MK, Page RE, Omholt SW. The gene csd is the primary signal for sexual development in the honeybee and encodes an SR-type protein. Cell (2003) 114:419–429.[CrossRef][ISI][Medline]

    Burkhard P, Stetefeld J, Strelkov SV. Coiled coils: a highly versatile protein folding motif. Trends Cell Biol (2001) 11:82–88.[CrossRef][ISI][Medline]

    Castric V, Vekemans X. Plant self-incompatibility in natural populations: a critical assessment of recent theoretical and empirical advances. Mol Ecol (2004) 13:2873–2889.[CrossRef][Medline]

    Charlesworth D, Bartolome C, Schierup MH, Mable BK. Haplotype structure of the stigmatic self-incompatibility gene in natural populations of Arabidopsis lyrata. Mol Biol Evol (2003) 20:1741–1753.[Abstract/Free Full Text]

    Cho S, Huang ZY, Green DR, Smith DR, Zhang J. Evolution of the complementary sex-determination gene of honey bees: balancing selection and trans-species polymorphisms. Genome Res (2006) 16:1366–1375.[Abstract/Free Full Text]

    Crozier RH. Genetics of sociality. In: Social insects—Hermann HR, ed. (1979) New York: Academic Press. 223–286.

    Eyre-Walker A, Keightley PD, Smith NG, Gaffney D. Quantifying the slightly deleterious mutation model of molecular evolution. Mol Biol Evol (2002) 19:2142–2149.[Abstract/Free Full Text]

    Garnery L, Cornuet J-M, Solignac M. Evolutionary history of the honeybee Apis mellifera inferred from mitochondrial DNA analysis. Mol Ecol (1992) 1:145–154.[Medline]

    Hasselmann M, Beye M. Signatures of selection among sex-determining alleles of the honey bee. Proc Natl Acad Sci USA (2004) 101:4888–4893.[Abstract/Free Full Text]

    Hasselmann M, Beye M. Pronounced differences of recombination activity at the sex determination locus (SDL) of the honey bee, a locus under strong balancing selection. Genetics (2006) 174:1469–1480.[Abstract/Free Full Text]

    Hey J, Wakeley J. A coalescent estimator of the population recombination rate. Genetics (1997) 145:833–846.[Abstract]

    Hudson RR, Kaplan NL. The coalescent process in models with selection and recombination. Genetics (1988) 120:831–840.